circad | circRNAs associated with diseases

circANKRD12
Gene	ANKRD12	Organism	Human
Genome Locus		Build	hg19
Disease	Various Cancer Cell Types	ICD-10	- (-)
DBLink		PMID	31185953
Experimental Method
Sample Type	Tissue and cell lines	Comparison	Ovarian cancer cell lines PA-1 (ATCC CRL-1572), SKOV3(ATCC HTB-77),Caov3(ATCC HTB-75), NIH:OVCAR-3 (ATCC HTB-161), breast cancer cell lines MDA-MB-231(ATCC HTB-26), MCF7(ATCC HTB-22),T-47D (ATCC HTB-133) and breast normal cell line MCF 10A(ATCC CRL-10317), Lung cancer cell lines, HCC2935(ATCC CRL-2869™) and NCI-H226 (ATCC CRL-5826) and Lung Normal Fibroblast cell line LL 24(ATCC CCL-151) (all from American type Cell Collection, Manassas, VA), APOCC (ovarian primary cell line derived from ascites fluid) (pers. communication Dr. Arash Tabrizi), A27809 (93112519-1VL,Sigma), A2780 CIS (93112519-1VL,Sigma)
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward TAAACATGGGGAGCGTCCAG Reverse GTGAACCCAGATTTGGGCATT	Statistics	Fold Change : Upregulated pvalue : <0.05
Citation
Karedath, T, Ahmed, I, Al Ameri, W, Al-Dasim, FM, Andrews, SS, Samuel, S, Al-Azwani, IK, Mohamoud, YA, Rafii, A, Malek, JA (2019). Silencing of ANKRD12 circRNA induces molecular and functional changes associated with invasive phenotypes. BMC Cancer, 19, 1:565.